The detailed information of tRNA gene sequence


Sequence ID>W1711399782
Genome IDMFGC01000010
Search identical group
Phylum/ClassCandidatusFalkowbacteria
SpeciesCandidatus Falkowbacteria bacterium RIFOXYA2_FULL_47_9 (MFGC)
Start position on genome 10632
End posion on genome 10706
Amino Acid Gly
Anticodon GCC
Upstream region at tRNA start position
aaatacactt
tRNA gene sequence
GCGGGTATCGTATAATGGTTATTATATTACCTTGCCAAGGTAGAGATACGGGTTCGATTC
CCGTTACCCGCTCCG
Downstream region at tRNA end position
tgagatttta
Secondary structure (Cloverleaf model)
>W1711399782	Gly	GCC
                   t      TCCG tgagatttta
                     G - C
                     C - G
                     G - C
                     G - C
                     G - C
                     T - A
                     A - T          T T
                    T     T G C C C     A
      T A A        C      | | | | |     G
    G       T A T G       A C G G G     C
    G         | | +                 T T
    T       T T A T
      T A          A     AGAT
                    T + G
                    T - A
                    A - T
                    C - G
                    C - G
                  T       A
                  T       A
                    G C C
Intron
Comment/Decision
Genome/Seq. Info.[ENA]

Comment
---
Input Comment
E-mail
Comment
Input this 5 letters

Attention:
When your comment is judged as an irrelevant one by the administrator,
your comment will be deleted by the administrator.

BACK