The detailed information of tRNA gene sequence


Sequence ID>W1711503289
Genome IDMKTL01000024
Search identical group
Phylum/ClassFirmicutes
SpeciesClostridiales bacterium 38-18 (MKTL)
Start position on genome 185001
End posion on genome 184925
Amino Acid Ile
Anticodon GAT
Upstream region at tRNA start position
caataattgt
tRNA gene sequence
GGGCGTATAGCTCAGCTGGTTAGAGCGCACGCCTGATAAGCGTGAGGTCGGTGGTTCGAG
TCCACTTATGCCCACCA
Downstream region at tRNA end position
caattatgcc
Secondary structure (Cloverleaf model)
>W1711503289	Ile	GAT
                   t      ACCA caattatgcc
                     G - C
                     G - C
                     G - C
                     C - G
                     G + T
                     T - A
                     A - T          T G
                    T     T C A C C     A
      C G A        A      + | | | |     G
    T       C T C G       G G T G G     C
    G       | | | |                 T T
    G       G A G C
      T T A        G     AGGTC
                    C - G
                    A - T
                    C - G
                    G - C
                    C - G
                  C       A
                  T       A
                    G A T
Intron
Comment/Decision
Genome/Seq. Info.[ENA]

Comment
---
Input Comment
E-mail
Comment
Input this 5 letters

Attention:
When your comment is judged as an irrelevant one by the administrator,
your comment will be deleted by the administrator.

BACK