The detailed information of tRNA gene sequence


Sequence ID>W1711582041
Genome IDMNUW01000068
Search identical group
Phylum/ClassBacteroidetes
SpeciesFlavobacteriaceae bacterium CG1_02_35_72 (MNUW)
Start position on genome 13234
End posion on genome 13158
Amino Acid Met
Anticodon CAT
Upstream region at tRNA start position
aataaacctc
tRNA gene sequence
GGCGAGGTAGCTCAGTTGGTTAGAGCGTCGGATTCATAACCCGGAGGTCTCGAGTTCAAT
TCTCGATCTCGCTACAA
Downstream region at tRNA end position
aaaaaacgtc
Secondary structure (Cloverleaf model)
>W1711582041	Met	CAT
                   c      ACAA aaaaaacgtc
                     G + T
                     G - C
                     C - G
                     G - C
                     A - T
                     G - C
                     G + T          T T
                    T     A G C T C     A
      T G A        A      | | | | |     A
    T       C T C G       T C G A G     C
    G       | | | |                 T T
    G       G A G C
      T T A        G     AGGTC
                    T + G
                    C - G
                    G - C
                    G - C
                    A   C
                  T       A
                  T       A
                    C A T
Intron
Comment/Decision
Genome/Seq. Info.[ENA]

Comment
---
Input Comment
E-mail
Comment
Input this 5 letters

Attention:
When your comment is judged as an irrelevant one by the administrator,
your comment will be deleted by the administrator.

BACK