The detailed information of tRNA gene sequence


Sequence ID>W1711584202
Genome IDMNYF01000220
Search identical group
Phylum/ClassDeltaproteobacteria
SpeciesDeltaproteobacteria bacterium CG2_30_43_15 (MNYF)
Start position on genome 5646
End posion on genome 5571
Amino Acid Met
Anticodon CAT
Upstream region at tRNA start position
tccctaatag
tRNA gene sequence
GGGCCCATAGCTCAGCTGGAAGAGCCACCGGCTCATAACCGGTAGGTCCCTGGTTCGAAC
CCAGGTGGGCCCACCA
Downstream region at tRNA end position
acgatcttac
Secondary structure (Cloverleaf model)
>W1711584202	Met	CAT
                   g      ACCA acgatcttac
                     G - C
                     G - C
                     G - C
                     C - G
                     C - G
                     C - G
                     A - T          C A
                    T     G G A C C     A
      C G A        A      | | | | |     G
    T       C T C G       C C T G G     C
    G       | | | |                 T T
    G       G A G C
      A A          C     AGGTC
                    A - T
                    C - G
                    C - G
                    G - C
                    G - C
                  C       A
                  T       A
                    C A T
Intron
Comment/Decision
Genome/Seq. Info.[ENA]

Comment
---
Input Comment
E-mail
Comment
Input this 5 letters

Attention:
When your comment is judged as an irrelevant one by the administrator,
your comment will be deleted by the administrator.

BACK