The detailed information of tRNA gene sequence


Sequence ID>W1711584838
Genome IDMNYY01000094
Search identical group
Phylum/ClassCandidatusAtribacteria
SpeciesCandidatus Atribacteria bacterium CG2_30_33_13 (MNYY)
Start position on genome 386
End posion on genome 462
Amino Acid Met
Anticodon CAT
Upstream region at tRNA start position
taaaatacga
tRNA gene sequence
CGCGGGGTGGAGCAGTCAGGTAGCTCGTCAGGCTCATAACCTGAAGGTCGGTGGTTCGAA
TCCGCCCCCCGCAACCA
Downstream region at tRNA end position
atttcaaaaa
Secondary structure (Cloverleaf model)
>W1711584838	Met	CAT
                   a      ACCA atttcaaaaa
                     C   A
                     G - C
                     C - G
                     G - C
                     G - C
                     G - C
                     G - C          T A
                    T     C C G C C     A
      T G A        G      | | + | |     G
    C       C G A G       G G T G G     C
    A       | | | |                 T T
    G       G C T C
      G T A        G     AGGTC
                    T - A
                    C - G
                    A - T
                    G - C
                    G - C
                  C       A
                  T       A
                    C A T
Intron
Comment/Decision
Genome/Seq. Info.[ENA]

Comment
---
Input Comment
E-mail
Comment
Input this 5 letters

Attention:
When your comment is judged as an irrelevant one by the administrator,
your comment will be deleted by the administrator.

BACK