The detailed information of tRNA gene sequence


Sequence ID>W1711585326
Genome IDMNZP01000003
Search identical group
Phylum/ClassDeltaproteobacteria
SpeciesSyntrophaceae bacterium CG2_30_49_12 (MNZP)
Start position on genome 316
End posion on genome 388
Amino Acid Thr
Anticodon GGT
Upstream region at tRNA start position
aacttaatct
tRNA gene sequence
GCCCACGTAGCTCAGTCGGTAGAGCACATCCTTGGTAAGGATGAGGTCACCAGTTCAATC
CTGGTCGTGGGCTtta
Downstream region at tRNA end position
tcttagtaaa
Secondary structure (Cloverleaf model)
>W1711585326	Thr	GGT
                   t      Ttta tcttagtaaa
                     G - C
                     C - G
                     C - G
                     C - G
                     A - T
                     C - G
                     G - C          C T
                    T     T G G T C     A
      T G A        A      | | | | |     A
    C       C T C G       A C C A G     C
    G       | | | |                 T T
    G       G A G C
      T A          A     AGGTC
                    C - G
                    A - T
                    T - A
                    C - G
                    C - G
                  T       A
                  T       A
                    G G T
Intron
Comment/Decision
Genome/Seq. Info.[ENA]

Comment
---
Input Comment
E-mail
Comment
Input this 5 letters

Attention:
When your comment is judged as an irrelevant one by the administrator,
your comment will be deleted by the administrator.

BACK