The detailed information of tRNA gene sequence


Sequence ID>W1711626077
Genome IDMPJE01000019
Search identical group
Phylum/ClassChlorobi
SpeciesChlorobium sp. KB01 (MPJE)
Start position on genome 35457
End posion on genome 35384
Amino Acid Thr
Anticodon GGT
Upstream region at tRNA start position
cgtgtgttat
tRNA gene sequence
GCTGATGTAGCTCAGTCGGTAGAGCACTTCCTTGGTAAGGAAGAGGTCATCGGTTCAAGT
CCGATCATCAGCTCag
Downstream region at tRNA end position
gttcttgggg
Secondary structure (Cloverleaf model)
>W1711626077	Thr	GGT
                   t      TCag gttcttgggg
                     G - C
                     C - G
                     T - A
                     G - C
                     A - T
                     T - A
                     G - C          T G
                    T     T A G C C     A
      T G A        A      | | | | |     A
    C       C T C G       A T C G G     C
    G       | | | |                 T T
    G       G A G C
      T A          A     AGGTC
                    C - G
                    T - A
                    T - A
                    C - G
                    C - G
                  T       A
                  T       A
                    G G T
Intron
Comment/Decision
Genome/Seq. Info.[ENA]

Comment
---
Input Comment
E-mail
Comment
Input this 5 letters

Attention:
When your comment is judged as an irrelevant one by the administrator,
your comment will be deleted by the administrator.

BACK