The detailed information of tRNA gene sequence


Sequence ID>W1711707969
Genome IDMSSX01000032
Search identical group
Phylum/ClassBacteroidetes
SpeciesAlgoriphagus faecimaris (MSSX)
Start position on genome 23948
End posion on genome 23872
Amino Acid Arg
Anticodon TCG
Upstream region at tRNA start position
taaagaatag
tRNA gene sequence
GCACTCGTAGTTCAACTGGATAGAATATCGGATTTCGGCTCCGAGGGTTGAGGGTTCGAA
TCCTTCCGAGTGCACCA
Downstream region at tRNA end position
aagctcagac
Secondary structure (Cloverleaf model)
>W1711707969	Arg	TCG
                   g      ACCA aagctcagac
                     G - C
                     C - G
                     A - T
                     C - G
                     T - A
                     C - G
                     G - C          T A
                    T     C T T C C     A
      C A A        A      | | + | |     G
    T       C T T G       G A G G G     C
    G       | | | +                 T T
    G       G A A T
      A T A        A     GGGTT
                    T - A
                    C - G
                    G - C
                    G - C
                    A - T
                  T       C
                  T       G
                    T C G
Intron
Comment/Decision
Genome/Seq. Info.[ENA]

Comment
---
Input Comment
E-mail
Comment
Input this 5 letters

Attention:
When your comment is judged as an irrelevant one by the administrator,
your comment will be deleted by the administrator.

BACK