The detailed information of tRNA gene sequence


Sequence ID>W1711792866
Genome IDMWLD01000003
Search identical group
Phylum/ClassCyanobacteria
SpeciesCandidatus Synechococcus spongiarum LMB bulk15M (MWLD)
Start position on genome 19902
End posion on genome 19992
Amino Acid Ser
Anticodon GCT
Upstream region at tRNA start position
aagtgccgcT
tRNA gene sequence
GGAGAGGTGGCTGAGTGGTTGAAAGCGGCTCCCTGCTAAGGAGTTACAGGAGGCAACTTC
TGTCGAGGGTTCGAATCCCTCCCTCTCCGTtc
Downstream region at tRNA end position
cttctgatcc
Secondary structure (Cloverleaf model)
>W1711792866	Ser	GCT
                   T      GTtc cttctgatcc
                     G - C
                     G - C
                     A - T
                     G - C
                     A - T
                     G - C
                     G - C          T A
                    T     C T C C C     A
      T G A        G      | | | | |     G
    G       G T C G       G A G G G     C
    G         | | |                 T T
    T       A A G C
      T G A        G     TACAGGAGGCAACTTCTGTC
                    G + T
                    C - G
                    T - A
                    C - G
                    C - G
                  C       A
                  T       A
                    G C T
Intron
Comment/Decision
Genome/Seq. Info.[ENA]

Comment
---
Input Comment
E-mail
Comment
Input this 5 letters

Attention:
When your comment is judged as an irrelevant one by the administrator,
your comment will be deleted by the administrator.

BACK