The detailed information of tRNA gene sequence


Sequence ID>W1711792944
Genome IDMWLF01000014
Search identical group
Phylum/ClassCyanobacteria
SpeciesCandidatus Synechococcus spongiarum LMB bulk10E (MWLF)
Start position on genome 4323
End posion on genome 4394
Amino Acid Gln
Anticodon TTG
Upstream region at tRNA start position
ctcccagcag
tRNA gene sequence
TGGGCCGTCGCCAAGTGGTAAGGCAGCGGGTTTTGGTCCCGCCATTCCTAGGTTCGAATC
CTAGCGGCCCAGttg
Downstream region at tRNA end position
acgtccttgt
Secondary structure (Cloverleaf model)
>W1711792944	Gln	TTG
                   g      Gttg acgtccttgt
                     T - A
                     G - C
                     G - C
                     G - C
                     C - G
                     C - G
                     G - C          T A
                    T     G A T C C     A
        G A        C      | | | | |     G
      T     A C C G       C T A G G     C
      G       | | |                 T T
      G     A G G C
        T A        A     CATTC
                    G - C
                    C - G
                    G - C
                    G - C
                    G - C
                  T       T
                  T       G
                    T T G
Intron
Comment/Decision
Genome/Seq. Info.[ENA]

Comment
---
Input Comment
E-mail
Comment
Input this 5 letters

Attention:
When your comment is judged as an irrelevant one by the administrator,
your comment will be deleted by the administrator.

BACK