The detailed information of tRNA gene sequence


Sequence ID>W1712038414
Genome IDNFIX01000009
Search identical group
Phylum/ClassBacteroidetes
SpeciesMuribaculum sp. An287 (NFIX)
Start position on genome 178
End posion on genome 252
Amino Acid Ile
Anticodon GAT
Upstream region at tRNA start position
atgcaataac
tRNA gene sequence
AGTCCCGTAGCTCAGTTGGTTAGAGCACTACACTGATAATGTAGGGGTCAGCAGTTCAAG
TCTGCTCGGGACTACag
Downstream region at tRNA end position
gtttgataag
Secondary structure (Cloverleaf model)
>W1712038414	Ile	GAT
                   c      ACag gtttgataag
                     A - T
                     G - C
                     T - A
                     C - G
                     C - G
                     C - G
                     G - C          T G
                    T     T C G T C     A
      T G A        A      | | | | |     A
    T       C T C G       A G C A G     C
    G       | | | |                 T T
    G       G A G C
      T T A        A     GGGTC
                    C - G
                    T - A
                    A - T
                    C - G
                    A - T
                  C       A
                  T       A
                    G A T
Intron
Comment/Decision
Genome/Seq. Info.[ENA]

Comment
---
Input Comment
E-mail
Comment
Input this 5 letters

Attention:
When your comment is judged as an irrelevant one by the administrator,
your comment will be deleted by the administrator.

BACK