The detailed information of tRNA gene sequence


Sequence ID>W1712096150
Genome IDNHZE01000040
Search identical group
Phylum/ClassGammaproteobacteria
SpeciesPantoea sp. VS1 (NHZE)
Start position on genome 147444
End posion on genome 147518
Amino Acid Arg
Anticodon CCT
Upstream region at tRNA start position
cgcgccgcac
tRNA gene sequence
GTCTCCTTAGTTAAATGGATATAACGAGCCCCTCCTAAGGGCTAGTTGCAGGTTCGATTC
CTGCAGGGGACACCA
Downstream region at tRNA end position
catcatcaag
Secondary structure (Cloverleaf model)
>W1712096150	Arg	CCT
                   c      ACCA catcatcaag
                     G - C
                     T - A
                     C - G
                     T + G
                     C - G
                     C - G
                     T - A          T T
                    T     C G T C C     A
      T A A        A      | | | | |     G
    G       A T T G       G C A G G     C
    G       | | | |                 T T
    A       T A A C
      T A          G     AGTT
                    A - T
                    G - C
                    C - G
                    C - G
                    C - G
                  C       A
                  T       A
                    C C T
Intron
Comment/Decision
Genome/Seq. Info.[ENA]

Comment
---
Input Comment
E-mail
Comment
Input this 5 letters

Attention:
When your comment is judged as an irrelevant one by the administrator,
your comment will be deleted by the administrator.

BACK