The detailed information of tRNA gene sequence


Sequence ID>W1712104600
Genome IDNIPV01000096
Search identical group
Phylum/ClassAlphaproteobacteria
SpeciesHaematobacter missouriensis (NIPV)
Start position on genome 54073
End posion on genome 53988
Amino Acid Leu
Anticodon TAA
Upstream region at tRNA start position
agagactgga
tRNA gene sequence
GGCCGCTTGCCGGAACCGGTAGACGGAGAGCACTTAAAATGCTTCGGGCCATGCCCGTGT
GGGTTCGAGTCCCACAGCGGCCACCA
Downstream region at tRNA end position
gattagttcg
Secondary structure (Cloverleaf model)
>W1712104600	Leu	TAA
                   a      ACCA gattagttcg
                     G - C
                     G - C
                     C - G
                     C - G
                     G - C
                     C - G
                     T - A          T G
                    T     C A C C C     A
      C A A        G      | | | | |     G
    C       G G C C       G T G G G     C
    G         | | |                 T T
    G       A C G G
      T A G        A     CGGGCCATGCCCGT
                    G + T
                    A - T
                    G - C
                    C - G
                    A - T
                  C       A
                  T       A
                    T A A
Intron
Comment/Decision
Genome/Seq. Info.[ENA]

Comment
---
Input Comment
E-mail
Comment
Input this 5 letters

Attention:
When your comment is judged as an irrelevant one by the administrator,
your comment will be deleted by the administrator.

BACK