| Sequence ID | >PL171000769 |
| Genome ID | CP010016 |
| Phylum/Class | Betaproteobacteria |
| Species | Burkholderia thailandensis 34 plasmid:unnamed |
| Start position on genome | 207360 |
| End posion on genome | 207436 |
| Amino Acid | Val |
| Anticodon | GAC |
| Upstream region at tRNA start position |
cagcttcttc |
| tRNA gene sequence |
AGGCTCGTAGCTCAGTTGGTTAGAGCACCACCTTGACATGGTGGGGGTCGTTGGTTCGAA |
| Downstream region at tRNA end position |
acgacattcg |
| Secondary structure (Cloverleaf model) | >PL171000769 Val GAC
c ACCA acgacattcg
A - T
G - C
G - C
C - G
T - A
C - G
G - C T A
T T A A C C A
T G A A + | | | | G
T C T C G G T T G G C
G | | | | T T
G G A G C
T T A A GGGTC
C - G
C - G
A - T
C - G
C - G
T T
T A
G A C
|
| Intron | |
| Comment/Decision | |
| Genome/Seq. Info. | [ENA] |
| Comment | |
| --- | |
| Input Comment |