| Sequence ID | >PL171001043 |
| Genome ID | CP015372 |
| Phylum/Class | Betaproteobacteria |
| Species | Pandoraea pnomenusa MCB032 plasmid:unnamed 1 |
| Start position on genome | 44903 |
| End posion on genome | 44977 |
| Amino Acid | Phe |
| Anticodon | GAA |
| Upstream region at tRNA start position |
gtatcgattt |
| tRNA gene sequence |
GCCTTGGTAGCTCAGTCGGTAGAGCGGCGGACTGAAAATCCGTGCGCCCAGGTTCGATTC |
| Downstream region at tRNA end position |
gacattgggg |
| Secondary structure (Cloverleaf model) | >PL171001043 Phe GAA
t ACCA gacattgggg
G - C
C - G
C - G
T T
T T
G - C
G - C T T
T G G T C C A
T G A A | | | | | G
C C T C G C C A G G C
G | | | | T T
G G A G C
T A G GCGC
G + T
C - G
G - C
G - C
A - T
C A
T A
G A A
|
| Intron | |
| Comment/Decision | |
| Genome/Seq. Info. | [ENA] |
| Comment | |
| --- | |
| Input Comment |