| Sequence ID | >PL171001208 |
| Genome ID | CP016005 |
| Phylum/Class | Betaproteobacteria |
| Species | Burkholderia sp. KK1 plasmid:pkk4 |
| Start position on genome | 432362 |
| End posion on genome | 432439 |
| Amino Acid | Pro |
| Anticodon | CGG |
| Upstream region at tRNA start position |
ttcggtttct |
| tRNA gene sequence |
CGGGGTATGGCCCAGCCTGGTTAAGGCGCCGCGTTCGGGACGCGGAGATCAGAGGTTCAA |
| Downstream region at tRNA end position |
gttttacgga |
| Secondary structure (Cloverleaf model) | >PL171001208 Pro CGG
t ACCA gttttacgga
C - G
G - C
G - C
G - C
G - C
T - A
A - T T C
T T C T C C A
C C G A G | | | | | A
T C C C G A G A G G C
G | | | T T
G A G G C
T T A G AGATC
C - G
C - G
G - C
C - G
G - C
T A
T G
C G G
|
| Intron | |
| Comment/Decision | |
| Genome/Seq. Info. | [ENA] |
| Comment | |
| --- | |
| Input Comment |