| Sequence ID | >A171000261 |
| Genome ID | CP000867 |
| Phylum/Class | Euryarchaeota |
| Species | Methanococcus maripaludis [CP000867] |
| Start position on genome | 962211 |
| End posion on genome | 962285 |
| Amino Acid | Met |
| Anticodon | CAT |
| Upstream region at tRNA start position |
gaccgggtac |
| tRNA gene sequence |
GGGCCCGTAGCTCAGGCTGGTTAGAGTGCTCGGCTCATAACCGAGTGGTCATGGGTTCAA |
| Downstream region at tRNA end position |
aatctgaaac |
| Secondary structure (Cloverleaf model) | >A171000261 Met CAT
c Atat aatctgaaac
G - C
G - C
G - C
C - G
C - G
C - G
G - C T A
T T A C C C A
C G G A A | | | | | A
T C T C G A T G G G C
G | | | + T T
G G A G T
T T A G TGGTC
C - G
T - A
C - G
G - C
G - C
C A
T A
C A T
|
| Intron | |
| Comment/Decision | |
| Genome/Seq. Info. | - |
| Comment | |
| --- | |
| Input Comment |