The detailed information of tRNA gene sequence


Sequence ID>A171005352
Genome IDCP009518
Search identical group
Phylum/ClassEuryarchaeota
SpeciesMethanococcoides methylutens MM1
Start position on genome 363250
End posion on genome 363324
Amino Acid Lys
Anticodon CTT
Upstream region at tRNA start position
catatgcttt
tRNA gene sequence
GGGCCGGTAGCTTAGTCAGGCAGAGCGATGGACTCTTAATCCATCGGCCGAGGGTTCAAA
TCCCTTCCGGCCCGCta
Downstream region at tRNA end position
caaatccaca
Secondary structure (Cloverleaf model)
>A171005352	Lys	CTT
                   t      GCta caaatccaca
                     G - C
                     G - C
                     G - C
                     C - G
                     C - G
                     G - C
                     G - C          T A
                    T     T T C C C     A
      T G A        A      + | | | |     A
    C       T T C G       G A G G G     C
    A       + | | |                 T T
    G       G A G C
      G C A        G     CGGCC
                    A - T
                    T - A
                    G - C
                    G - C
                    A - T
                  C       A
                  T       A
                    C T T
Intron
Comment/Decision
Genome/Seq. Info.-

Comment
---
Input Comment
E-mail
Comment
Input this 5 letters

Attention:
When your comment is judged as an irrelevant one by the administrator,
your comment will be deleted by the administrator.

BACK