| Sequence ID | >A17A000087 |
| Genome ID | CP001140 |
| Phylum/Class | Thermoproteota |
| Species | Desulfurococcus amylolyticus 1221n [CP001140] |
| Start position on genome | 895249 |
| End posion on genome | 895364 |
| Amino Acid | Ser |
| Anticodon | CGA |
| Upstream region at tRNA start position |
actaaatgaT |
| tRNA gene sequence |
GCCGCCGTAGCTCAGCCTGGTTAGAGCGCCGGACTCGAGATCCGGTTGTCCCGGGTTCAA |
| Downstream region at tRNA end position |
tgttctttaa |
| Secondary structure (Cloverleaf model) | >A17A000087 Ser CGA
T ATCt tgttctttaa
G - C
C - G
C - G
G - C
C - G
C - G
G - C T G
T G G C C C A
C C G A A | | | | | A
T C T C G C C G G G C
G | | | | T T
G G A G C
T T A G TTGTC
C - G
C - G
G - C
G - C
A - T
C A
T G
C*G A
intron: position=35, length=38 (in A-loop)
ATACGGGTTCACGGGTCCGTACCGAGGTCTGCCCAGGG
|
| Intron | |
| Comment/Decision | |
| Genome/Seq. Info. | - |
| Comment | |
| --- | |
| Input Comment |