| Sequence ID | >A17A000519 |
| Genome ID | CP002426 |
| Phylum/Class | Thermoproteota |
| Species | Sulfolobus islandicus HVE10/4 [CP002426] |
| Start position on genome | 1145795 |
| End posion on genome | 1145891 |
| Amino Acid | Ser |
| Anticodon | GGA |
| Upstream region at tRNA start position |
tttattaaag |
| tRNA gene sequence |
GGGGCCGTAGTCTAGCTTGGACTAGGATGCCAGCCTGGAACGCTGGTGGTCCCGGGTTCA |
| Downstream region at tRNA end position |
ttagggggag |
| Secondary structure (Cloverleaf model) | >A17A000519 Ser GGA
g Attg ttagggggag
G - C
G - C
G - C
G - C
C - G
C - G
G - C T A
T G G C C C A
T C G A A | | | | | A
T T C T G C C G G G C
G + | | + T T
G G G A T
A C T A G TGGTC
C - G
C - G
A - T
G - C
C - G
C C
T A
G G*A
intron: position=36, length=21 (in A-loop)
GGATACTACCCTAACCACCAG
|
| Intron | |
| Comment/Decision | |
| Genome/Seq. Info. | - |
| Comment | |
| --- | |
| Input Comment |