| Sequence ID | >A179000129 |
| Genome ID | CP001939 |
| Phylum/Class | Thermoproteota |
| Species | Thermosphaera aggregans DSM 11486 [CP001939] |
| Start position on genome | 1079185 |
| End posion on genome | 1079078 |
| Amino Acid | Ser |
| Anticodon | CGA |
| Upstream region at tRNA start position |
gtttaaatag |
| tRNA gene sequence |
GCCGGGGTGCCCGAGCGGTCTAAGGGGGTGGGCTCGAGACCCACTGCCCCCTCTGGGGCA |
| Downstream region at tRNA end position |
ctcctttcat |
| Secondary structure (Cloverleaf model) | >A179000129 Ser CGA
g Gcta ctcctttcat
G - C
C - G
C - G
G - C
G - C
G - C
G - C T A
T C G C C C A
C G A G | | | | | G
G G C C C G C G G G C
G | | | T T
T A G G G
C T A G TGCCCCCTCTGGGGCAC
G - C
T - A
G - C
G - C
G - C
C A
T G *
C G A
intron: position=38, length=22 (in A-loop)
ACTTCCGGCATCTCCCCGGGAG
|
| Intron | |
| Comment/Decision | |
| Genome/Seq. Info. | - |
| Comment | |
| --- | |
| Input Comment |