| Sequence ID | >A179000145 |
| Genome ID | CP001941 |
| Phylum/Class | Unclassified |
| Species | Aciduliprofundum boonei T469 [CP001941] |
| Start position on genome | 367578 |
| End posion on genome | 367458 |
| Amino Acid | Gln |
| Anticodon | TTG |
| Upstream region at tRNA start position |
ctaaaggcat |
| tRNA gene sequence |
AGCCCCGTGGTGTAGCGGTCAAGCATGCGGGACTTTGGATCCCGCGACGGGGGTTCGAAT |
| Downstream region at tRNA end position |
ctcttctccc |
| Secondary structure (Cloverleaf model) | >A179000145 Gln TTG
t Gcta ctcttctccc
A - T
G - C
C - G
C - G
C - G
C - G
G - C T A
T C C T C C A
C G A G | | + | | G
G T G T G G G G G G C
G + | | + T T
T G C A T
C A A G CGAC
C - G
G - C
G - C
G - C
A - T
C A
T G *
T T G
intron: position=38, length=48 (in A-loop)
CGAAGCCCCTTTGGAAAAGGTGCTTTACCCCCAAAGGGCTTCGAGGAG
|
| Intron | |
| Comment/Decision | |
| Genome/Seq. Info. | - |
| Comment | |
| --- | |
| Input Comment |