The detailed information of tRNA gene sequence


Sequence ID>C171049443
Genome IDCP016432
Search identical group
Phylum/ClassChlorobi
SpeciesProsthecochloris sp. CIB 2401 (CP016432)
Start position on genome 263560
End posion on genome 263633
Amino Acid Thr
Anticodon GGT
Upstream region at tRNA start position
acacttcgtt
tRNA gene sequence
GCTGATGTAGCTCAGTCGGTAGAGCACTTCCTTGGTAAGGAAGAGGTCATCGGTTCAAGT
CCGATCATCAGCTCtc
Downstream region at tRNA end position
atggaaatgg
Secondary structure (Cloverleaf model)
>C171049443	Thr	GGT
                   t      TCtc atggaaatgg
                     G - C
                     C - G
                     T - A
                     G - C
                     A - T
                     T - A
                     G - C          T G
                    T     T A G C C     A
      T G A        A      | | | | |     A
    C       C T C G       A T C G G     C
    G       | | | |                 T T
    G       G A G C
      T A          A     AGGTC
                    C - G
                    T - A
                    T - A
                    C - G
                    C - G
                  T       A
                  T       A
                    G G T
Intron
Comment/Decision
Genome/Seq. Info.-

Comment
---
Input Comment
E-mail
Comment
Input this 5 letters

Attention:
When your comment is judged as an irrelevant one by the administrator,
your comment will be deleted by the administrator.

BACK