The detailed information of tRNA gene sequence


Sequence ID>C171060552
Genome IDCP017305
Search identical group
Phylum/ClassChlorobi
SpeciesChlorobaculum limnaeum DSM 1677 (CP017305)
Start position on genome 82922
End posion on genome 82997
Amino Acid Thr
Anticodon GGT
Upstream region at tRNA start position
ttggtgataa
tRNA gene sequence
GCTGATGTAGCTCAGTCGGTAGAGCACTTCCTTGGTAAGGAAGAGGTCATCGGTTCAAGT
CCGATCATCAGCTCCG
Downstream region at tRNA end position
gttcctggag
Secondary structure (Cloverleaf model)
>C171060552	Thr	GGT
                   a      TCCG gttcctggag
                     G - C
                     C - G
                     T - A
                     G - C
                     A - T
                     T - A
                     G - C          T G
                    T     T A G C C     A
      T G A        A      | | | | |     A
    C       C T C G       A T C G G     C
    G       | | | |                 T T
    G       G A G C
      T A          A     AGGTC
                    C - G
                    T - A
                    T - A
                    C - G
                    C - G
                  T       A
                  T       A
                    G G T
Intron
Comment/Decision
Genome/Seq. Info.-

Comment
---
Input Comment
E-mail
Comment
Input this 5 letters

Attention:
When your comment is judged as an irrelevant one by the administrator,
your comment will be deleted by the administrator.

BACK