The detailed information of tRNA gene sequence


Sequence ID>C171060589
Genome IDCP017305
Search identical group
Phylum/ClassChlorobi
SpeciesChlorobaculum limnaeum DSM 1677 (CP017305)
Start position on genome 1196154
End posion on genome 1196081
Amino Acid Cys
Anticodon GCA
Upstream region at tRNA start position
ggttcacttt
tRNA gene sequence
GGTGAAGTGGCCGAGTGGCTAGGCAGAGGTCTGCAAAACCTCGTACAGCGGTTCGAATCC
GCTCTTCACCTCCA
Downstream region at tRNA end position
gacacccgca
Secondary structure (Cloverleaf model)
>C171060589	Cys	GCA
                   t      TCCA gacacccgca
                     G - C
                     G - C
                     T - A
                     G - C
                     A - T
                     A - T
                     G - C          T A
                    T     T C G C C     A
        G A        G      | | | | |     G
      T     G C C G       A G C G G     C
      G       | | |                 T T
      G     A G G C
        C T        A     GTAC
                    G - C
                    A - T
                    G - C
                    G - C
                    T - A
                  C       A
                  T       A
                    G C A
Intron
Comment/Decision
Genome/Seq. Info.-

Comment
---
Input Comment
E-mail
Comment
Input this 5 letters

Attention:
When your comment is judged as an irrelevant one by the administrator,
your comment will be deleted by the administrator.

BACK