The detailed information of tRNA gene sequence


Sequence ID>C171072572
Genome IDCP018091
Search identical group
Phylum/ClassCyanobacteria
SpeciesSynechococcus sp. SynAce01 (CP018091)
Start position on genome 767828
End posion on genome 767899
Amino Acid Thr
Anticodon GGT
Upstream region at tRNA start position
ccttccacat
tRNA gene sequence
GCCCTTGTAGCTCAGCGGTAGAGCACTCCCTTGGTAAGGGAGAGGTCACGAGTTCAATTC
TCGTCAAGGGCTttc
Downstream region at tRNA end position
aacgttgcaa
Secondary structure (Cloverleaf model)
>C171072572	Thr	GGT
                   t      Tttc aacgttgcaa
                     G - C
                     C - G
                     C - G
                     C - G
                     T - A
                     T - A
                     G - C          T T
                    T     T G C T C     A
        G A        A      | | | | |     A
      C     C T C G       A C G A G     C
      G     | | | |                 T T
      G     G A G C
        T A        A     AGGTC
                    C - G
                    T - A
                    C - G
                    C - G
                    C - G
                  T       A
                  T       A
                    G G T
Intron
Comment/Decision
Genome/Seq. Info.-

Comment
---
Input Comment
E-mail
Comment
Input this 5 letters

Attention:
When your comment is judged as an irrelevant one by the administrator,
your comment will be deleted by the administrator.

BACK