The detailed information of tRNA gene sequence


Sequence ID>C171072584
Genome IDCP018091
Search identical group
Phylum/ClassCyanobacteria
SpeciesSynechococcus sp. SynAce01 (CP018091)
Start position on genome 1881309
End posion on genome 1881390
Amino Acid Leu
Anticodon GAG
Upstream region at tRNA start position
tgatggccac
tRNA gene sequence
GCGGATGTGGTGGAATTGGTAGACACGCACGTTTGAGGGGCGTGTGGCTTCGGCCTTGCG
AGTTCAAGTCTCGCCATCCGCAttt
Downstream region at tRNA end position
ttctttaagc
Secondary structure (Cloverleaf model)
>C171072584	Leu	GAG
                   c      Attt ttctttaagc
                     G - C
                     C - G
                     G - C
                     G - C
                     A - T
                     T - A
                     G - C          T G
                    T     C G C T C     A
      T A A        G      | | | | |     A
    T       G G T G       G C G A G     C
    G         | | |                 T T
    G       A C A C
      T A G        G     TGGCTTCGGCCTT
                    C - G
                    A - T
                    C - G
                    G - C
                    T + G
                  T       G
                  T       G
                    G A G
Intron
Comment/Decision
Genome/Seq. Info.-

Comment
---
Input Comment
E-mail
Comment
Input this 5 letters

Attention:
When your comment is judged as an irrelevant one by the administrator,
your comment will be deleted by the administrator.

BACK