The detailed information of tRNA gene sequence


Sequence ID>C171072596
Genome IDCP018091
Search identical group
Phylum/ClassCyanobacteria
SpeciesSynechococcus sp. SynAce01 (CP018091)
Start position on genome 1695330
End posion on genome 1695240
Amino Acid Ser
Anticodon GCT
Upstream region at tRNA start position
gatcgccccT
tRNA gene sequence
GGAGAGGTGGCTGAGTGGTTGAAAGCGGCTCCCTGCTAAGGAGTTACAGGAGGCAACTTC
TGTCGAGGGTTCGAATCCCTCCCTCTCCGTtt
Downstream region at tRNA end position
ctttgatgcc
Secondary structure (Cloverleaf model)
>C171072596	Ser	GCT
                   T      GTtt ctttgatgcc
                     G - C
                     G - C
                     A - T
                     G - C
                     A - T
                     G - C
                     G - C          T A
                    T     C T C C C     A
      T G A        G      | | | | |     G
    G       G T C G       G A G G G     C
    G         | | |                 T T
    T       A A G C
      T G A        G     TACAGGAGGCAACTTCTGTC
                    G + T
                    C - G
                    T - A
                    C - G
                    C - G
                  C       A
                  T       A
                    G C T
Intron
Comment/Decision
Genome/Seq. Info.-

Comment
---
Input Comment
E-mail
Comment
Input this 5 letters

Attention:
When your comment is judged as an irrelevant one by the administrator,
your comment will be deleted by the administrator.

BACK