| Sequence ID | >C171080624 |
| Genome ID | CP018495 |
| Phylum/Class | Alphaproteobacteria |
| Species | Brucella melitensis BwIM_ITA_45 [CP018494, CP018495] |
|
Start position on genome
|
1088280
|
|
End posion on genome
|
1088204
|
|
Amino Acid
|
Ile
|
|
Anticodon
|
GAT
|
|
Upstream region at tRNA start position
|
gtcggtatct
|
|
tRNA gene sequence
|
GGGCTTGTAGCTCAGTTGGTTAGAGCACACGCTTGATAAGCGTGGGGTCGGAGGTTCAAG TCCTCCCAGGCCCACCA
|
|
Downstream region at tRNA end position
|
agttacttga
|
| Secondary structure (Cloverleaf model) | >C171080624 Ile GAT
t ACCA agttacttga
G - C
G - C
G - C
C - G
T + G
T - A
G - C T G
T C C T C C A
T G A A | | | | | A
T C T C G G G A G G C
G | | | | T T
G G A G C
T T A A GGGTC
C - G
A - T
C - G
G - C
C - G
T A
T A
G A T
|
| Intron | |
| Comment/Decision | |
| Genome/Seq. Info. | - |