The detailed information of tRNA gene sequence


Sequence ID>C171097720
Genome IDCP019646
Search identical group
Phylum/ClassPlanctomycetes
SpeciesPhycisphaerae bacterium SM-Chi-D1 (CP019646)
Start position on genome 2285595
End posion on genome 2285667
Amino Acid Phe
Anticodon GAA
Upstream region at tRNA start position
cttgacctaa
tRNA gene sequence
GGGCAGGTAGCTCAGTTGGTAGAGCAACGGACTGAAAATCCGTGTGTCGGCGGTTCAAAT
CCGCCCCTGCCCAttc
Downstream region at tRNA end position
cataaagctt
Secondary structure (Cloverleaf model)
>C171097720	Phe	GAA
                   a      Attc cataaagctt
                     G - C
                     G - C
                     G - C
                     C - G
                     A - T
                     G - C
                     G - C          T A
                    T     C C G C C     A
      T G A        A      | | | | |     A
    T       C T C G       G G C G G     C
    G       | | | |                 T T
    G       G A G C
      T A          A     GTGTC
                    A - T
                    C - G
                    G - C
                    G - C
                    A - T
                  C       A
                  T       A
                    G A A
Intron
Comment/Decision
Genome/Seq. Info.-

Comment
---
Input Comment
E-mail
Comment
Input this 5 letters

Attention:
When your comment is judged as an irrelevant one by the administrator,
your comment will be deleted by the administrator.

BACK