The detailed information of tRNA gene sequence


Sequence ID>C171118585
Genome IDCP021383
Search identical group
Phylum/ClassActinobacteria
SpeciesCellulosimicrobium cellulans PSBB019 (CP021383)
Start position on genome 2481354
End posion on genome 2481283
Amino Acid Gly
Anticodon CCC
Upstream region at tRNA start position
ccagcgccgc
tRNA gene sequence
GCGGGTGTAGTTCAATGGTAGAACTTCAGCTTCCCAAGCTGATAGCGCGGGTTCGATTCC
CGTCACCCGCTCag
Downstream region at tRNA end position
cacacgagag
Secondary structure (Cloverleaf model)
>C171118585	Gly	CCC
                   c      TCag cacacgagag
                     G - C
                     C - G
                     G - C
                     G - C
                     G - C
                     T - A
                     G - C          T T
                    T     T G C C C     A
        A A        A      + | | | |     G
      T     C T T G       G C G G G     C
      G     | | | |                 T T
      G     G A A C
        T A        T     TAGC
                    T - A
                    C - G
                    A - T
                    G - C
                    C - G
                  T       A
                  T       A
                    C C C
Intron
Comment/Decision
Genome/Seq. Info.-

Comment
---
Input Comment
E-mail
Comment
Input this 5 letters

Attention:
When your comment is judged as an irrelevant one by the administrator,
your comment will be deleted by the administrator.

BACK