The detailed information of tRNA gene sequence


Sequence ID>C171126313
Genome IDCP021920
Search identical group
Phylum/ClassFirmicutes
SpeciesBacillus sonorensis SRCM101395 (CP021920)
Start position on genome 3765937
End posion on genome 3765865
Amino Acid Ala
Anticodon GGC
Upstream region at tRNA start position
tcaaacaaac
tRNA gene sequence
GGGGCATTAGCTCAGCTGGGAGAGCGCTACACTGGCAGTGTAGAGGTCAGCGGTTCGAGC
CCGCTATGCTCCAtct
Downstream region at tRNA end position
tacgtaaaat
Secondary structure (Cloverleaf model)
>C171126313	Ala	GGC
                   c      Atct tacgtaaaat
                     G - C
                     G - C
                     G + T
                     G - C
                     C - G
                     A - T
                     T - A          C G
                    T     T C G C C     A
      C G A        A      | | | | |     G
    T       C T C G       A G C G G     C
    G       | | | |                 T T
    G       G A G C
      G A          G     AGGTC
                    C - G
                    T - A
                    A - T
                    C - G
                    A - T
                  C       G
                  T       A
                    G G C
Intron
Comment/Decision
Genome/Seq. Info.-

Comment
---
Input Comment
E-mail
Comment
Input this 5 letters

Attention:
When your comment is judged as an irrelevant one by the administrator,
your comment will be deleted by the administrator.

BACK