The detailed information of tRNA gene sequence


Sequence ID>C171128304
Genome IDLT578417
Search identical group
Phylum/ClassCyanobacteria
SpeciesCyanobium sp. NIES-981 (LT578417)
Start position on genome 2729139
End posion on genome 2729057
Amino Acid Leu
Anticodon GAG
Upstream region at tRNA start position
gttgcatcat
tRNA gene sequence
GCGGATGTGGTGGAATTGGTAGACACGCACGTTTGAGGGGCGTGTGGCTTCGGCCTTGCG
AGTTCAAGTCTCGCCATCCGCACtt
Downstream region at tRNA end position
ttttctggct
Secondary structure (Cloverleaf model)
>C171128304	Leu	GAG
                   t      ACtt ttttctggct
                     G - C
                     C - G
                     G - C
                     G - C
                     A - T
                     T - A
                     G - C          T G
                    T     C G C T C     A
      T A A        G      | | | | |     A
    T       G G T G       G C G A G     C
    G         | | |                 T T
    G       A C A C
      T A G        G     TGGCTTCGGCCTT
                    C - G
                    A - T
                    C - G
                    G - C
                    T + G
                  T       G
                  T       G
                    G A G
Intron
Comment/Decision
Genome/Seq. Info.-

Comment
---
Input Comment
E-mail
Comment
Input this 5 letters

Attention:
When your comment is judged as an irrelevant one by the administrator,
your comment will be deleted by the administrator.

BACK