The detailed information of tRNA gene sequence


Sequence ID>C171128311
Genome IDLT578417
Search identical group
Phylum/ClassCyanobacteria
SpeciesCyanobium sp. NIES-981 (LT578417)
Start position on genome 1642878
End posion on genome 1642805
Amino Acid Gln
Anticodon TTG
Upstream region at tRNA start position
ccaccgacaT
tRNA gene sequence
TGGGCCGTCGCCAAGTGGTAAGGCAGCGGGTTTTGGTCCCGCCATTCCTAGGTTCGAATC
CTAGCGGCCCAGTtt
Downstream region at tRNA end position
ttccccagca
Secondary structure (Cloverleaf model)
>C171128311	Gln	TTG
                   T      GTtt ttccccagca
                     T - A
                     G - C
                     G - C
                     G - C
                     C - G
                     C - G
                     G - C          T A
                    T     G A T C C     A
        G A        C      | | | | |     G
      T     A C C G       C T A G G     C
      G       | | |                 T T
      G     A G G C
        T A        A     CATTC
                    G - C
                    C - G
                    G - C
                    G - C
                    G - C
                  T       T
                  T       G
                    T T G
Intron
Comment/Decision
Genome/Seq. Info.-

Comment
---
Input Comment
E-mail
Comment
Input this 5 letters

Attention:
When your comment is judged as an irrelevant one by the administrator,
your comment will be deleted by the administrator.

BACK