The detailed information of tRNA gene sequence


Sequence ID>W131216791
Genome IDATWD01000001
Search identical group
Phylum/ClassAcidobacteria
SpeciesAcidobacteriaceae bacterium TAA166 [ATWD]
Start position on genome 3106469
End posion on genome 3106544
Amino Acid Thr
Anticodon CGT
Upstream region at tRNA start position
cgttccaagc
tRNA gene sequence
GCCGATGTAGCTCAGCTGGTAGAGCAACTGATTCGTAATCAGTAGGTCAGCGGTTCAAAT
CCGCTCATCGGCTCCA
Downstream region at tRNA end position
tacttctcct
Secondary structure (Cloverleaf model)
>W131216791	Thr	CGT
                   c      TCCA tacttctcct
                     G - C
                     C - G
                     C - G
                     G - C
                     A - T
                     T - A
                     G - C          T A
                    T     T C G C C     A
      C G A        A      | | | | |     A
    T       C T C G       A G C G G     C
    G       | | | |                 T T
    G       G A G C
      T A          A     AGGTC
                    A - T
                    C - G
                    T - A
                    G - C
                    A - T
                  T       A
                  T       A
                    C G T
Intron
Comment/Decision
Genome/Seq. Info.[ENA]

Comment
---
Input Comment
E-mail
Comment
Input this 5 letters

Attention:
When your comment is judged as an irrelevant one by the administrator,
your comment will be deleted by the administrator.

BACK