The detailed information of tRNA gene sequence


Sequence ID>C005323
Genome IDCP000108
Search identical group
Phylum/ClassChlorobi
SpeciesChlorobium chlorochromatii CaD3
Start position on genome 570415
End posion on genome 570333
Amino Acid Ser
Anticodon TGA
Upstream region at tRNA start position
actctacaat
tRNA gene sequence
GGAGGATTAGTCTAATTGGTAAGGCAGCAGTCTTGAAAACTGCCGGGTTAACACCCTTGG
GGGTTCGAGTCCCTCATCCTCCGctc
Downstream region at tRNA end position
tcttttttaa
Secondary structure (Cloverleaf model)
>C005323	Ser	TGA
                   t      Gctc tcttttttaa
                     G - C
                     G - C
                     A - T
                     G - C
                     G - C
                     A - T
                     T - A          T G
                    T     C T C C C     A
      T A A        A      | + | | |     G
    T       T C T G       G G G G G     C
    G       | | + |                 T T
    G       A G G C
      T A          A     CGGGTTAACACCCTT
                    G - C
                    C - G
                    A - T
                    G - C
                    T - A
                  C       A
                  T       A
                    T G A
Intron
Comment/Decision
Genome/Seq. Info.[Ensembl]

Comment
---
Input Comment
E-mail
Comment
Input this 5 letters

Attention:
When your comment is judged as an irrelevant one by the administrator,
your comment will be deleted by the administrator.

BACK