The detailed information of tRNA gene sequence


Sequence ID>C006575
Genome IDCP000492
Search identical group
Phylum/ClassChlorobi
SpeciesChlorobium phaeobacteroides DSM 266
Start position on genome 253131
End posion on genome 253203
Amino Acid Thr
Anticodon GGT
Upstream region at tRNA start position
ttgttgagtg
tRNA gene sequence
GCTGATGTAGCTCAGTCGGTAGAGCACTTCCTTGGTAAGGAAGAGGTCATCGGTTCAAGT
CCGATCATCAGCTcag
Downstream region at tRNA end position
gttttggcag
Secondary structure (Cloverleaf model)
>C006575	Thr	GGT
                   g      Tcag gttttggcag
                     G - C
                     C - G
                     T - A
                     G - C
                     A - T
                     T - A
                     G - C          T G
                    T     T A G C C     A
      T G A        A      | | | | |     A
    C       C T C G       A T C G G     C
    G       | | | |                 T T
    G       G A G C
      T A          A     AGGTC
                    C - G
                    T - A
                    T - A
                    C - G
                    C - G
                  T       A
                  T       A
                    G G T
Intron
Comment/Decision
Genome/Seq. Info.[Ensembl]

Comment
---
Input Comment
E-mail
Comment
Input this 5 letters

Attention:
When your comment is judged as an irrelevant one by the administrator,
your comment will be deleted by the administrator.

BACK