The detailed information of tRNA gene sequence


Sequence ID>C006585
Genome IDCP000492
Search identical group
Phylum/ClassChlorobi
SpeciesChlorobium phaeobacteroides DSM 266
Start position on genome 1053357
End posion on genome 1053430
Amino Acid His
Anticodon GTG
Upstream region at tRNA start position
agtttctatg
tRNA gene sequence
GTGATTGTAGCTCAGTTGGTTAGAGCGCCAGGTTGTGGCCCTGGAGGTCGGGGGTTCGAG
TCCCCTCATTCACCcgt
Downstream region at tRNA end position
gtttttttgg
Secondary structure (Cloverleaf model)
>C006585	His	GTG
                   g      Ccgt gtttttttgg
                     G - C
                     T - A
                     G - C
                     A - T
                     T   T
                     T - A
                     G - C          T G
                    T     T C C C C     A
      T G A        A      + | | | |     G
    T       C T C G       G G G G G     C
    G       | | | |                 T T
    G       G A G C
      T T A        G     AGGTC
                    C - G
                    C - G
                    A - T
                    G - C
                    G - C
                  T       C
                  T       G
                    G T G
Intron
Comment/Decision
Genome/Seq. Info.[Ensembl]

Comment
---
Input Comment
E-mail
Comment
Input this 5 letters

Attention:
When your comment is judged as an irrelevant one by the administrator,
your comment will be deleted by the administrator.

BACK