The detailed information of tRNA gene sequence


Sequence ID>C016738
Genome IDCP000096
Search identical group
Phylum/ClassChlorobi
SpeciesPelodictyon luteolum DSM 273
Start position on genome 826422
End posion on genome 826497
Amino Acid Arg
Anticodon TCT
Upstream region at tRNA start position
gagtgacgac
tRNA gene sequence
GTGCCCGTAGCTCAATGGATAGAGCATCAGCCTTCTAAGCTGAGGGTTACTGGTTCGAGT
CCAGTCGGGCACACCA
Downstream region at tRNA end position
ttggaagtcc
Secondary structure (Cloverleaf model)
>C016738	Arg	TCT
                   c      ACCA ttggaagtcc
                     G - C
                     T - A
                     G - C
                     C - G
                     C - G
                     C - G
                     G - C          T G
                    T     T G A C C     A
      T A A        A      | | | | |     G
    G       C T C G       A C T G G     C
    G       | | | |                 T T
    A       G A G C
      T A          A     GGGTT
                    T - A
                    C - G
                    A - T
                    G - C
                    C - G
                  C       A
                  T       A
                    T C T
Intron
Comment/Decision
Genome/Seq. Info.[Ensembl]

Comment
---
Input Comment
E-mail
Comment
Input this 5 letters

Attention:
When your comment is judged as an irrelevant one by the administrator,
your comment will be deleted by the administrator.

BACK