The detailed information of tRNA gene sequence


Sequence ID>C016739
Genome IDCP000096
Search identical group
Phylum/ClassChlorobi
SpeciesPelodictyon luteolum DSM 273
Start position on genome 826529
End posion on genome 826604
Amino Acid His
Anticodon GTG
Upstream region at tRNA start position
gttttctatg
tRNA gene sequence
GTGATTGTAGCTCAGTTGGTTAGAGCGCCAGGTTGTGGCCCTGGAGGTCGGGGGTTCGAG
TCCCCTCATTCACCCAt
Downstream region at tRNA end position
gttttttggc
Secondary structure (Cloverleaf model)
>C016739	His	GTG
                   g      CCAt gttttttggc
                     G - C
                     T - A
                     G - C
                     A - T
                     T   T
                     T - A
                     G - C          T G
                    T     T C C C C     A
      T G A        A      + | | | |     G
    T       C T C G       G G G G G     C
    G       | | | |                 T T
    G       G A G C
      T T A        G     AGGTC
                    C - G
                    C - G
                    A - T
                    G - C
                    G - C
                  T       C
                  T       G
                    G T G
Intron
Comment/Decision
Genome/Seq. Info.[Ensembl]

Comment
---
Input Comment
E-mail
Comment
Input this 5 letters

Attention:
When your comment is judged as an irrelevant one by the administrator,
your comment will be deleted by the administrator.

BACK