The detailed information of tRNA gene sequence


Sequence ID>C016747
Genome IDCP000096
Search identical group
Phylum/ClassChlorobi
SpeciesPelodictyon luteolum DSM 273
Start position on genome 1525362
End posion on genome 1525446
Amino Acid Leu
Anticodon CAG
Upstream region at tRNA start position
ataacgcgtt
tRNA gene sequence
GCCCGAATGGCGGAACTGGTAGACGCACTCGTTTCAGGGACGAGCGCCGCAAGGTGTAGG
AGTTCGAATCTCCTTTCGGGCACAA
Downstream region at tRNA end position
acaagttttc
Secondary structure (Cloverleaf model)
>C016747	Leu	CAG
                   t      ACAA acaagttttc
                     G - C
                     C - G
                     C - G
                     C - G
                     G - C
                     A - T
                     A - T          T A
                    T     T C C T C     A
      C A A        G      | | | | |     G
    T       G G C G       A G G A G     C
    G         | | |                 T T
    G       A C G C
      T A G        A     CGCCGCAAGGTGT
                    C - G
                    T - A
                    C - G
                    G - C
                    T - A
                  T       G
                  T       G
                    C A G
Intron
Comment/Decision
Genome/Seq. Info.[Ensembl]

Comment
---
Input Comment
E-mail
Comment
Input this 5 letters

Attention:
When your comment is judged as an irrelevant one by the administrator,
your comment will be deleted by the administrator.

BACK