The detailed information of tRNA gene sequence


Sequence ID>C016758
Genome IDCP000096
Search identical group
Phylum/ClassChlorobi
SpeciesPelodictyon luteolum DSM 273
Start position on genome 1928123
End posion on genome 1928051
Amino Acid Phe
Anticodon GAA
Upstream region at tRNA start position
tgaatgcgat
tRNA gene sequence
GGACAGATAGCTCAGTTGGTAGAGCAATGGACTGAAAATCCATGTGTCGTGGGTTCGATT
CCCTCTCTGTCCActt
Downstream region at tRNA end position
tttcgtagta
Secondary structure (Cloverleaf model)
>C016758	Phe	GAA
                   t      Actt tttcgtagta
                     G - C
                     G - C
                     A - T
                     C - G
                     A - T
                     G - C
                     A - T          T T
                    T     C T C C C     A
      T G A        A      |   | | |     G
    T       C T C G       G T G G G     C
    G       | | | |                 T T
    G       G A G C
      T A          A     GTGTC
                    A - T
                    T - A
                    G - C
                    G - C
                    A - T
                  C       A
                  T       A
                    G A A
Intron
Comment/Decision
Genome/Seq. Info.[Ensembl]

Comment
---
Input Comment
E-mail
Comment
Input this 5 letters

Attention:
When your comment is judged as an irrelevant one by the administrator,
your comment will be deleted by the administrator.

BACK