The detailed information of tRNA gene sequence


Sequence ID>C016774
Genome IDCP000096
Search identical group
Phylum/ClassChlorobi
SpeciesPelodictyon luteolum DSM 273
Start position on genome 346020
End posion on genome 345943
Amino Acid Asp
Anticodon GTC
Upstream region at tRNA start position
actctttcac
tRNA gene sequence
GGAGCTGTAGCTCAGTCTGGTTAGAGCGCCTGCCTGTCACGCAGGAGGTCGCGGGTTCGA
GCCCCGTCAGCTCCGCAA
Downstream region at tRNA end position
ggaaacaagg
Secondary structure (Cloverleaf model)
>C016774	Asp	GTC
                   c      GCAA ggaaacaagg
                     G - C
                     G - C
                     A - T
                     G - C
                     C - G
                     T - A
                     G - C          C G
                    T     T G C C C     A
    C T G A        A      + | | | |     G
  T         C T C G       G C G G G     C
  G         | | | |                 T T
  G         G A G C
    T T A          G     AGGTC
                    C - G
                    C - G
                    T - A
                    G - C
                    C - G
                  C       C
                  T       A
                    G T C
Intron
Comment/Decision
Genome/Seq. Info.[Ensembl]

Comment
---
Input Comment
E-mail
Comment
Input this 5 letters

Attention:
When your comment is judged as an irrelevant one by the administrator,
your comment will be deleted by the administrator.

BACK