The detailed information of tRNA gene sequence


Sequence ID>C017039
Genome IDBX548175
Search identical group
Phylum/ClassCyanobacteria
SpeciesProchlorococcus marinus str. MIT 9313
Start position on genome 1689905
End posion on genome 1689824
Amino Acid Leu
Anticodon GAG
Upstream region at tRNA start position
agtcggccac
tRNA gene sequence
GCGGATGTGGTGGAATTGGTAGACACGCACGTTTGAGGGGCGTGTGGCTTCGGCCTTGCG
AGTTCAAGTCTCGCCATCCGCAttc
Downstream region at tRNA end position
tttccttaca
Secondary structure (Cloverleaf model)
>C017039	Leu	GAG
                   c      Attc tttccttaca
                     G - C
                     C - G
                     G - C
                     G - C
                     A - T
                     T - A
                     G - C          T G
                    T     C G C T C     A
      T A A        G      | | | | |     A
    T       G G T G       G C G A G     C
    G         | | |                 T T
    G       A C A C
      T A G        G     TGGCTTCGGCCTT
                    C - G
                    A - T
                    C - G
                    G - C
                    T + G
                  T       G
                  T       G
                    G A G
Intron
Comment/Decision
Genome/Seq. Info.[Ensembl]

Comment
---
Input Comment
E-mail
Comment
Input this 5 letters

Attention:
When your comment is judged as an irrelevant one by the administrator,
your comment will be deleted by the administrator.

BACK