The detailed information of tRNA gene sequence


Sequence ID>C017150
Genome IDCP000095
Search identical group
Phylum/ClassCyanobacteria
SpeciesProchlorococcus marinus str. NATL2A
Start position on genome 1048263
End posion on genome 1048175
Amino Acid Ser
Anticodon GCT
Upstream region at tRNA start position
tatggggaat
tRNA gene sequence
GGAGAGGTGGCTGAGTGGTTGAAAGCGGCTCCCTGCTAAGGAGTTACAGGAGGCAACTTC
TGTCGAGGGTTCGAATCCCTCCCTCTCCGttt
Downstream region at tRNA end position
ttcattagat
Secondary structure (Cloverleaf model)
>C017150	Ser	GCT
                   t      Gttt ttcattagat
                     G - C
                     G - C
                     A - T
                     G - C
                     A - T
                     G - C
                     G - C          T A
                    T     C T C C C     A
      T G A        G      | | | | |     G
    G       G T C G       G A G G G     C
    G         | | |                 T T
    T       A A G C
      T G A        G     TACAGGAGGCAACTTCTGTC
                    G + T
                    C - G
                    T - A
                    C - G
                    C - G
                  C       A
                  T       A
                    G C T
Intron
Comment/Decision
Genome/Seq. Info.[Ensembl]

Comment
---
Input Comment
E-mail
Comment
Input this 5 letters

Attention:
When your comment is judged as an irrelevant one by the administrator,
your comment will be deleted by the administrator.

BACK