The detailed information of tRNA gene sequence


Sequence ID>C018263
Genome IDCP000607
Search identical group
Phylum/ClassChlorobi
SpeciesProsthecochloris vibrioformis DSM 265
Start position on genome 1674367
End posion on genome 1674295
Amino Acid Phe
Anticodon GAA
Upstream region at tRNA start position
tctcttcaat
tRNA gene sequence
GGACAGATAGCTCAGTTGGTAGAGCAATGGACTGAAAATCCATGTGTCGTGGGTTCGATT
CCCTCTCTGTCCActt
Downstream region at tRNA end position
cttcgtcgtt
Secondary structure (Cloverleaf model)
>C018263	Phe	GAA
                   t      Actt cttcgtcgtt
                     G - C
                     G - C
                     A - T
                     C - G
                     A - T
                     G - C
                     A - T          T T
                    T     C T C C C     A
      T G A        A      |   | | |     G
    T       C T C G       G T G G G     C
    G       | | | |                 T T
    G       G A G C
      T A          A     GTGTC
                    A - T
                    T - A
                    G - C
                    G - C
                    A - T
                  C       A
                  T       A
                    G A A
Intron
Comment/Decision
Genome/Seq. Info.[Ensembl]

Comment
---
Input Comment
E-mail
Comment
Input this 5 letters

Attention:
When your comment is judged as an irrelevant one by the administrator,
your comment will be deleted by the administrator.

BACK