The detailed information of tRNA gene sequence


Sequence ID>C018266
Genome IDCP000607
Search identical group
Phylum/ClassChlorobi
SpeciesProsthecochloris vibrioformis DSM 265
Start position on genome 1256833
End posion on genome 1256758
Amino Acid His
Anticodon GTG
Upstream region at tRNA start position
gttttcaacg
tRNA gene sequence
GTGATTGTAGCTCAGTTGGTTAGAGCGCCAGGTTGTGGCCCTGGAGGTCGGGGGTTCGAG
TCCCCTCATTCACCCAt
Downstream region at tRNA end position
gttttttggc
Secondary structure (Cloverleaf model)
>C018266	His	GTG
                   g      CCAt gttttttggc
                     G - C
                     T - A
                     G - C
                     A - T
                     T   T
                     T - A
                     G - C          T G
                    T     T C C C C     A
      T G A        A      + | | | |     G
    T       C T C G       G G G G G     C
    G       | | | |                 T T
    G       G A G C
      T T A        G     AGGTC
                    C - G
                    C - G
                    A - T
                    G - C
                    G - C
                  T       C
                  T       G
                    G T G
Intron
Comment/Decision
Genome/Seq. Info.[Ensembl]

Comment
---
Input Comment
E-mail
Comment
Input this 5 letters

Attention:
When your comment is judged as an irrelevant one by the administrator,
your comment will be deleted by the administrator.

BACK