The detailed information of tRNA gene sequence


Sequence ID>C018270
Genome IDCP000607
Search identical group
Phylum/ClassChlorobi
SpeciesProsthecochloris vibrioformis DSM 265
Start position on genome 1190073
End posion on genome 1189991
Amino Acid Ser
Anticodon TGA
Upstream region at tRNA start position
ctttacataa
tRNA gene sequence
GGAGGATTAGTCTAATTGGTAAGGCAGCAGTCTTGAAAACTGCCGGGTTAACACCCTTGG
GGGTTCGAGTCCCTCATCCTCCGcac
Downstream region at tRNA end position
caaaacctgg
Secondary structure (Cloverleaf model)
>C018270	Ser	TGA
                   a      Gcac caaaacctgg
                     G - C
                     G - C
                     A - T
                     G - C
                     G - C
                     A - T
                     T - A          T G
                    T     C T C C C     A
      T A A        A      | + | | |     G
    T       T C T G       G G G G G     C
    G       | | + |                 T T
    G       A G G C
      T A          A     CGGGTTAACACCCTT
                    G - C
                    C - G
                    A - T
                    G - C
                    T - A
                  C       A
                  T       A
                    T G A
Intron
Comment/Decision
Genome/Seq. Info.[Ensembl]

Comment
---
Input Comment
E-mail
Comment
Input this 5 letters

Attention:
When your comment is judged as an irrelevant one by the administrator,
your comment will be deleted by the administrator.

BACK