The detailed information of tRNA gene sequence


Sequence ID>C018275
Genome IDCP000607
Search identical group
Phylum/ClassChlorobi
SpeciesProsthecochloris vibrioformis DSM 265
Start position on genome 803048
End posion on genome 802967
Amino Acid Leu
Anticodon CAG
Upstream region at tRNA start position
tttctttttg
tRNA gene sequence
GCCCGAATGGCGGAACTGGTAGACGCACTCGTTTCAGGGACGAGCGCCGCAAGGTGTAGG
AGTTCGAATCTCCTTTCGGGCAcat
Downstream region at tRNA end position
aaaaagcttc
Secondary structure (Cloverleaf model)
>C018275	Leu	CAG
                   g      Acat aaaaagcttc
                     G - C
                     C - G
                     C - G
                     C - G
                     G - C
                     A - T
                     A - T          T A
                    T     T C C T C     A
      C A A        G      | | | | |     G
    T       G G C G       A G G A G     C
    G         | | |                 T T
    G       A C G C
      T A G        A     CGCCGCAAGGTGT
                    C - G
                    T - A
                    C - G
                    G - C
                    T - A
                  T       G
                  T       G
                    C A G
Intron
Comment/Decision
Genome/Seq. Info.[Ensembl]

Comment
---
Input Comment
E-mail
Comment
Input this 5 letters

Attention:
When your comment is judged as an irrelevant one by the administrator,
your comment will be deleted by the administrator.

BACK