The detailed information of tRNA gene sequence


Sequence ID>C018279
Genome IDCP000607
Search identical group
Phylum/ClassChlorobi
SpeciesProsthecochloris vibrioformis DSM 265
Start position on genome 411488
End posion on genome 411414
Amino Acid Asp
Anticodon GTC
Upstream region at tRNA start position
actctttaac
tRNA gene sequence
GGAGCTGTAGCTCAGTCTGGTTAGAGCGCCTGCCTGTCACGCAGGAGGTCGCGGGTTCGA
GCCCCGTCAGCTCCGctg
Downstream region at tRNA end position
aaaaaaaggt
Secondary structure (Cloverleaf model)
>C018279	Asp	GTC
                   c      Gctg aaaaaaaggt
                     G - C
                     G - C
                     A - T
                     G - C
                     C - G
                     T - A
                     G - C          C G
                    T     T G C C C     A
    C T G A        A      + | | | |     G
  T         C T C G       G C G G G     C
  G         | | | |                 T T
  G         G A G C
    T T A          G     AGGTC
                    C - G
                    C - G
                    T - A
                    G - C
                    C - G
                  C       C
                  T       A
                    G T C
Intron
Comment/Decision
Genome/Seq. Info.[Ensembl]

Comment
---
Input Comment
E-mail
Comment
Input this 5 letters

Attention:
When your comment is judged as an irrelevant one by the administrator,
your comment will be deleted by the administrator.

BACK